elow 25. Which letter represents the most recent common ancestor of the monophyl
ID: 3164841 • Letter: E
Question
elow 25. Which letter represents the most recent common ancestor of the monophyletic group that comtalins terminal taxo 'B and 'E' a) X b) Y c) d) Y or 2 e) None of the above. 26. What type of phylogenetic grouping would "BCD' constitute? o) Monophyletic b) Polyphyletic c) Paraphyletic d) Two of the above may be applicoble e) None of the above. Questions 27-29 are based on the phylogeny and associated data matrix below: ânacardium occidentals ACCGTGAACTGGCATACAAAGA Maogifena indica ACCGTGAACTGGCATACAAAGA Antrocarcyan amazonicum ACCGTGAACTGCCATACATAGA Pegia nitida ACCGTGAACTGCCATACATAGA Rhus aromatica ACCGTGAACTGGCATACATAGA Bucsera (ancestor) ACGGIGAACTGGCATACATAGA -?engene ndes Pegle nitida 27. What is the synapomorphy that defines node 'X2 a) A transition from DNA nucleotide C to nucleotide G at sequence position 2 b) A transition from DNA nucleotide A to nucleotide T at sequence position3 c) A transition from DNA Rucleotide G to nucleotide C at sequence position 1. d) Both (a) and (b). e) None of the above.Explanation / Answer
Answer 25. Y represent the most recent common ancestor of monophyletic group that contain terminal taxa B and E.
Answer 26. BCD Polyphletic type of phylogenetic grouping as C and D is on different branche while B is on different branch.
Answer 27. None of the above as synomorphy as synamorphy means derived character from ancestor as there is transition in A B C and D option which result in Apomorphy.
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.