Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

There are two main sections here: Replication and Gene Expression. Replication o

ID: 3166438 • Letter: T

Question

There are two main sections here: Replication and Gene Expression. Replication of DNA Strand. This is copying of the DNA new cells molecule for the purpose of making 1. Show the nucleotide bases (letters) that would be represented in the corresponding strand of DNA from the strand above DNA: TACGCAACACGAGATTTAGGTTGGTAGTGGCAC Gene Expression of a gene on a DNA strand. This is decoding the genes on DNA for the purpose of making necessary proteins. 2. Transcription of DNA Strand into mRNA occurs in the nucleus. Transcribe DNA into RNA. DNA: TACGCAACACGAGATTTAGGTTGGTAGTGGCAC mRNA: 3. Translation of mRNA codons into amino acids. The above mRNA leaves the nucleus and goes to a ribosome (rRNA) in the cytoplasm. The code is based on the mRNA molecule. Notice the first amino acid from this gene. It is always the start codon. If you were to get toa stop codon, write stop and don't translate any more (though there isn't a stop codon here). Protein: Note: Use the DNA code that is in your textbook or online to translate the mRNA strand into an amino acid.

Explanation / Answer

Ans. #1. The sequence of corresponding strand is complementary to the given strand.

Given strand:                         TACGCAACACGAGATTTAGGTTGGTAGTGGCAC

Complementary strand:       ATGCGTTGTGCTCTAAATCCAACCATCACCGTG

#2. The sequence of mRNA is complementary to template DNA strand. T in DNA is replaced by U in mRNA.

DNA:               3’-TACGCAACACGAGATTTAGGTTGGTAGTGGCAC–3’

mRNA:            5’- AUGCGUUGUGCUCUAAAUCCAACCAUCACCGUG-3’

#3. Protein:    MRCALNPTITV

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote