A new species of sea horse has been discovered and is being sequenced The genome
ID: 317719 • Letter: A
Question
A new species of sea horse has been discovered and is being sequenced The genome of the new species is being aligned using the reference sequence from a already-known species of sea horse Since the two species are evolutionary diverged, there may be some differences between their sequences Reference sequence: ACCTACATTCACAGAATGAT Fragments a) Align the set of mini-fragments above. b) How are the sequences of the two sea horse species different? c) Would this alignment have been easier or more difficult if you didn't have any reference sequence at all (alignment without a reference is called "de novo")? Explain d) If there had been sequencing errors, would this alignment have been easier or more difficult? Explain.Explanation / Answer
A) TAGATT TGAATG TCACTGA
B) There is a form of polymorphism occurring in the new sequence of the genes for the new species of sea horses. There is single nucleotide polymorphism in the new species as C is replaced by T and A instead of G which may probably occurred due to some sort of mutation during genetic sequencing.
C) The given alignment would be difficult without reference DNA sequence as reference sequence gives basic DNA information and a reference database techniques is much easier than performing a de novo technique though de novo methods are well established using mass spectra nowadays but still having a reference database helps and gives the better coding information of protein sequence.
D) if there had been a sequence error there would be difficulty in alignment and in that case we have to perform de novo sequencing using mass spectra analysis. To know the sequence of the species and other information regarding the DNA characters.
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.