Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

You are given the sequence of a gene below. You need to design a forward primer

ID: 323813 • Letter: Y

Question

You are given the sequence of a gene below. You need to design a forward primer and a reverse primer for this gene. You will introduce an NdeI cut site upstream of your gene, and a XhoI cut site downstream of the gene. Primer length should be between 20-25 bases. You must write the primer sequences from the 5’ à 3’ direction in the space at the bottom of this page. Underline the restriction recognition sequences in your primers (10 pts)

NdeI recognition sequence: CATATG         XhoI recognition sequence: CTCGAG

Forward: ____________________________________________________________

Reverse:_____________________________________________________________

Explanation / Answer

Forward primers (20 bp)

5'--->3'

TTTAGGACAACTACGCCGGG (plus strand)

Reverse primers (20 bp)

3'---->5'

CTAGCTAGCTTGGGGCAACA (minus strand)

There don't seem to be any restriction sites for the above restriction enzymes in the primer sequences.

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote