Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Polyphenol oxidase (PPO) is an enzyme that functions as a defense mechanism in s

ID: 324515 • Letter: P

Question

Polyphenol oxidase (PPO) is an enzyme that functions as a defense mechanism in some plants. The enzyme converts some toxic compounds into inert compounds, thereby protecting the plant. The amino acid sequence of the toxin-binding region is highly conserved (similar) among various plant species. Shown below is a portion of a PPO sequence from a species of tomato. This stretch encodes one of the toxin binding regions. Is this sequence DNA or RNA? UUUUAUGAGCGGAUUCUCGGGAGCCUAAUAGAUAACCCCACCUUUGCC 3' Since green algae are closely related to vascular plants, you are interested in seeing if algae have the PPO gene and you decide to use PCR to see if the algae have any genes that contain this binding site. You collect the algae, isolate the DNA, and make primers that will recognize the sequence above. Which of the following primers will allow you to best amplify your area of interest and obtain the target PCR product? Select the two (2) correct primers. 5' CCGTTT 3' 5' GGCAAA 3' 3' AAAAUA 5' 5' TTTTAT 3' 5' AAAATA 3' What (in addition to the primers) will you need to amplify the DNA from your algal sample?

Explanation / Answer

This sequence is a RNA sequence the presence of Uracil indicating that Uracil is absent in DNA sequence.

The DNA sequence for this mRNA will be

a) F.P sequence will be

5TTTTA3

R.P

5GGCAAA3

B. Along with primer we need Template DNA

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote