Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

College level Genetics Please do not answer if cannot complete all the questions

ID: 324776 • Letter: C

Question

College level Genetics

Please do not answer if cannot complete all the questions

Define

1. Reading frame –

2. Wobble –

Fill in the Blank

3. After eukaryotic transcription, exons are brought together after introns are ______________________ out.

4. DNA can encode mRNA, rRNA, and tRNA, but only ____________________ is translated into a polypeptide.

True or False

5. Ribosomes initiate translation after associating with a promoter.

6. Transcription termination is triggered by a stop codon.

Short Answer

7. Compare and contrast gene expression in prokaryotes and eukaryotes.

8. Given the following template stand of DNA, determine the sequence of the RNA like strand, mRNA, and resulting amino acids and note the polarity of all sequences.

5’ TACCATGTCTCGAGTAGATCCATGATT3’

Explanation / Answer

1. Reading frame is the grouping of three successive bases on a sequence of DNA that constitues the codons for the amino acids encoded by the DNA.

2. Wobble: A wobble base pair is a pairing between two nucleotides in RNA molecules that does not follow watson-crick base-pair rules.

3. Splicing. Splicing is a process of removing the introns from the DNA chain and after this exons are litigated together.

4. mRNA. Only mRNA among all these RNAs are translated into polypeptide chain.

5. An initiation complex for translation forms by the assembly of the ribosomal subunits and initiator tRNA (met-tRNA) at the start codon on the mRNA. This statement is false.

6. True. The termination is initiated by a stop codon. In RNA, UAG, UAA, UGA acts as stop codon while In DNA,TAG, TAA and TGA acts as stop Codon.

7. Prokaryotic transcription and translation occur simultaneously in the cytoplasm, and regulation occurs at the transcriptional level. Eukaryotic gene expression is regulated during transcription and RNA processing, which take place in the nucleus, and during protein translation, which takes place in the cytoplasm.

8. DNA chain- 5'- TACCATGTCTCGAGTAGATCCATGATT-3'

mRNA Chain- 5'- AUG-GUA-CAG-AGC-UCA-UCU-AGG-UAC-UAA-3'

Polypeptide - Met-val-Gln-Ser-Ser-Ser-Arg-Tyr-Stop

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote