Problem 1. This RNA sequence contains one complete open reading frame (ORF). A c

Question

Problem 1. This RNA sequence contains one complete open reading frame (ORF). A complete open reading frame contains an AUG start codon and an in-frame stop codon. 5' GGCUUAUGUAGUAAUGAUAUGCCUUAUUUUAGCCUGAUAGUC 3' 1A. TRANSLATE this sequence. Write the primary sequence using the three letter code. Example: +3HN-ala-his-lys-arg-Coo- 1B. Draw the chemical structure of this polypeptide. 1C. What is the approximate molecular weight of this polypeptide? The average molecular weight of an amino acid in a polypeptide (including the side chain) is 115 Daltons.

Explanation / Answer

Problem 1:

5

Related Questions

Navigate

• Browse (All)
• Browse P
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.