Here\'s a genome: 5\'-GAT GTA TAATCGAGACATC C CTTAGAAATGCTTCTGCCATGGTTATTCCCACAA
ID: 3466 • Letter: H
Question
Here's a genome:5'-GATGTATAATCGAGACATCCCTTAGAAATGCTTCTGCCATGGTTATTCCCACAAA-3'
The transcription start site has been bold-italicized.
a. What is the transcriptional regulatory element presentupstream of the transcription start site, and describe itsfunction.
My answer: The TATA box which is located in the promoterregion. It helps in the binding of transcription factors (I'mguess, I do not know).
b. Underline the translation initiation codon.
It's AUG right? I underlined GTA which is read backwards asAUG.
Explanation / Answer
First of all let me saythat the mechanism of transcription is the synthesis of RNA. For this to occur the DNAstrand which is 3'-5' direction acts as the template and not the5'- 3' strand. The DNA strand given by you isin 5'-3' direction, so; RNA cannot be synthesized from thisstrand. The complementary strandof this can act as a template for transcription. So, the complementarystrand for this will be as:( the highlighted one) 5'-GATGTATAATCGAGACATCCCTTAGAAATGCTTCTGCCATGGTT ATTCCCACAAA-3'3'- CTACATATTAGCTCTGTAGGGAATCTTTACGAAGACGGTACCAATAAGGGTG TTT-5' The RNA strand for this isrepresented as:(the red strand) 3'- CTACAT ATTAG CTCTGT AGGGAATCTTT ACGAAGACGGT ACCAATAAGGGTG TTT-5' 5'- GAUGUAUAAUCGAGACAUCCCUUAGAAAUGCUUCUGCCAUGGUUAUUCCCACAAA-3' The transcriptionalregulatory element present upstream of transcription start site isthe promoter region. This is the right answer ofyours. But, if this genome is ofprokaryotes, the promoter region will be as TATAAT and if itis eukaryotic then it is as TATAAA(TATA box) Yeah, promoter regionhelps RNA polymerase to bind in prokaryotes and in eukaryotestranscription factors will bind to it. The function of promoterregion is to help RNA polymerase recognise the transcription siteand the DNA also starts to unwind in thisregion to initiate transcription The transcriptionalregulatory element present upstream of transcription start site isthe promoter region. This is the right answer ofyours. But, if this genome is ofprokaryotes, the promoter region will be as TATAAT and if itis eukaryotic then it is as TATAAA(TATA box) Yeah, promoter regionhelps RNA polymerase to bind in prokaryotes and in eukaryotestranscription factors will bind to it. The function of promoterregion is to help RNA polymerase recognise the transcription siteand the DNA also starts to unwind in thisregion to initiate transcription Yeah your answer for thecodon for initiation of translation AUG is right. But your sense in this iswrong. I mean, you said GTA is read in backwards as AUG: this isnot true and in any way GTA cannot code forAUG I didnot find any TATA boxin the DNA strand or the AUG codon in the RNA strand. I hope this answer helpedyou.
Related Questions
Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.