5\'... GCT AAGTATTGCTCAAGATTAGGATGATAAATAACTGG3\' 3\'... CGA TTCATAACGAGTTCTAATC

Question

5'...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG3'

3'...CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC5'

Sequence of wild-type DNA that encodes the last amino acids of a protein that is 270 amino acids long. The bolded letters indicate the frame and include the coding region.

A change of one base pair leads to the protein increasing in length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair to for the protein to increase in length by one amino acid.

Explanation / Answer

A codon is a set of three nucleotides, a triplet that code for a certain amino acid. The first codon establishes the reading frame, whereby a new codon begins. A protein?s amino acid backbone sequence is defined by contiguous triplets. Codons are key to translation of genetic information for the synthesis of proteins. The reading frame is set when translating the mRNA begins and is maintained as it reads one triplet to the next. The reading of the genetic code is subject to three rules the monitor codons in mRNA. First, codons are read in a 5' to 3' direction. Second, codons are nonoverlapping and the message has no gaps. The last rule, as stated above, that the message is translated in a fixed reading frame

A frameshift mutation (also called a framing error or a reading frame shift) is a genetic mutation caused by insertions or deletions)of a number of nucleotides in a DNA sequence that is not divisible by three. Due to the triplet nature of gene expression by codons, the insertion or deletion can change the reading frame (the grouping of the codons), resulting in a completely different translation from the original. The earlier in the sequence the deletion or insertion occurs, the more altered the protein.

Related Questions

Navigate

• Browse (All)
• Browse 5
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.