Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

I used 5\'-TCCAccATGGCAACTCTAAAGGATCAG-3\' for forward primer and 5\'-CAGAAagCTT

ID: 44384 • Letter: I

Question

I used 5'-TCCAccATGGCAACTCTAAAGGATCAG-3' for forward primer

and 5'-CAGAAagCTTTAAAATTGCAGCTCC-3' for reverse primer.

Use the sequence of the primers that you used for your PCR reaction in order do creat the entire sequence of LDH..

atggcaactctaaaggatcagctgatttataatcttctaaaggaagaacagaccccccagaataagattacagttgttggggttggtgctgttggcatggcctgtgccatcagtatcttaatgaaggacttggcagatgaacttgctcttgttgatgtcatcgaagacaaattgaagggagagatgatggatctccaacatggcagccttttccttagaacaccaaagattgtctctggcaaagactataatgtaactgcaaactccaagctggtcattatcacggctggggcacgtcagcaagagggagaaagccgtcttaatttggtccagcgtaacgtgaacatctttaaattcatcattcctaatgttgtaaaatacagcccgaactgcaagttgcttattgtttcaaatccagtggatatcttgacctacgtggcttggaagataagtggttttcccaaaaaccgtgttattggaagtggttgcaatctggattcagcccgattccgttacctgatgggggaaaggctgggagttcacccattaagctgtcatgggtgggtccttggggaacatggagattccagtgtgcctgtatggagtggaatgaatgttgctggtgtctctctgaagactctgcacccagatttagggactgataaagataaggaacagtggaaagaggttcacaagcaggtggttgagagtgcttatgaggtgatcaaactcaaaggctacacatcctgggctattggactctctgtagcagatttggcagagagtataatgaagaatcttaggcgggtgcacccagtttccaccatgattaagggtctttacggaataaaggatgatgtcttccttagtgttccttgcattttgggacagaatggaatctcagaccttgtgaaggtgactctgacttctgaggaagaggcccgtttgaagaagagtgcagatacactttgggggatccaaaaggagctgcaattttaa

Please help me how to do this..

Explanation / Answer

5

Related Questions

I understand the theory behind Bayesian networks, and am wondering what it takes
Question #648041
I understand the theory behind the use salts in hash functions, but when I see i
Question #651484
I understand the true stress and true strain equations, but in this chapter, the
Question #1849153
I understand the utility in having one application remember a bunch of long, ran
Question #661549
I understand there is a 1:2 ratio and before doing the initial concentrations th
Question #493306
I understand this book. The other book we are using, I setup the code in text ed
Question #3751913
I understand this is a homework problem. I don\'t expect anyone to do my homewor
Question #1259257
I understand this is a slightly vague question, but there are results for P vs.
Question #652221
Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote

Navigate

Previous
I use to watch the status bar of my browser and note that when I visit a site ma
Next
I used 9 methods. I broke the problem into small pieces. I used a method to solv

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.