Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

ID: hsvander Exam Name: HomBisc336F15-Problem Set 2 part 1 SofT v. 11.0 4780.362

ID: 51682 • Letter: I

Question

ID: hsvander Exam Name: HomBisc336F15-Problem Set 2 part 1 SofT v. 11.0 4780.36236 Support: 866-429-8889 Question 7 of 7 Actions First Previous Exit/Save Larger Smaller Reset Shot-gun sequencing was a pivotal approach used in the Human Genome sequencing project, and now has become the standard approach to genome sequencing (cf. lllumina's sequencing technology). The following are reads from a genomic clone of the Drosophila melanogaster (fruit fly) genome read 1: 5'-TGGCCGTGATGGGCAGTTCCGG TG-3' read 2: 5'-TTCCGG TGCCGGAAAGA 3' read 3: 5 -CTATCCGGGCGAACTTTTGGCCG-3' read 4: 5'-CA CCGGAACTGCCCATCACG-3' read 5: 5 TTGGCCGTGATGGGCAGTT-3' read 6: 5 -CGAACTTTTGGCCGTGATGGGCAG TTCC-3' Using these all six reads, create a sequence contig for this region of the D. melanogaster genome. What is this sequence? (Make sure to carefully enter the entire sequence.) What is the length of the assembled contig for this region? Enter a number Gust digits, no commas or periods) Using the resources at FlyBase (http://flybase.org), answer this: on what D. melanogaster chromosome can this sequence be found (choose the Please provide your answer below, and click "Exit/Save' to submit your exam. please enter please enter your answer here Question 7 Fill in the Blank Elapsed time: 74 minutes (not timed) A Nav Calculator Alarm Number Flag Answered YES YES YES YES YES No No 09:29 PM Battery: 59% Last Saved :09:29 PM :29 PM 9/10/2015

Explanation / Answer

Human genome project short gun sequencing ;

short gun sequencing is method used for the long DNA standard . the DNA can be broken up randomly into numerous short small segments which are sequenced using the chain termination method .multiple overlapping sequences reads during the multiple fragmentation and sequencing .short gun sequencing is the main apporch for the full genome sequencing .

the coding sequence of the entire genome for the 6 reads ;

5 CGAACTTTTGGCCGGATGGGCAGTTCCGGTGAAAGA 3'"

what is the length of the assembled coding region ?

the length of the coding region is 35 base pairs long

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote