Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

The sequence of the messenger RNA molecule (primary transcript) synthesized from

ID: 58263 • Letter: T

Question

The sequence of the messenger RNA molecule (primary transcript) synthesized from a DNA molecule with a coding strand having the sequence 5 ATGCTACCGTTA is: 5 UACGAUGGCAAU. 5 UAACGGUAGCAU. 5 AUGCUACCGUUA. 5 AUUGCCAUCGUA. None of these choices is correct. The sequence of the messenger RNA molecule (primary transcript) synthesized from a DNA molecule with a coding strand having the sequence 5 ATGCTACCGTTA is: 5 UACGAUGGCAAU. 5 UAACGGUAGCAU. 5 AUGCUACCGUUA. 5 AUUGCCAUCGUA. None of these choices is correct.

Explanation / Answer

The sequence of the messenger RNA molecule (primary transcript) synthesized from a DNA molecule with a coding strand having the sequence 5 ATGCTACCGTTA 3' is:

5 AUGCUACCGUUA 3'

The sequence of the messenger RNA molecule (primary transcript) synthesized from a DNA molecule with a coding strand having the sequence 5 ATGCTACCGTTA 3' is:

5 AUGCUACCGUUA 3'

Related Questions

The semester is fast approaching its end and you are preparing for graduation. Y
Question #3660266
The semester project will require the student to summarize the nutrition recomme
Question #52517
The semi-strong form EMH states that A. all market trading data B. all publicly
Question #2792184
The semi-strong form of the efficient market hypothesis asserts that all publicl
Question #1200451
The semiannual dividend on 8% cumulative preferred, $61 par value, 7,900 shares
Question #2374126
The semiconductor AIP has a band gap that produces light of wavelength of about
Question #891432
The semiconductor business of the California Microtech Corporation qualifies as
Question #2467149
The semiconductor business of the California Microtech Corporation qualifies as
Question #2546270
Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote

Navigate

Previous
The sequence of operation to implement the process illustrated in Figure C2 is t
Next
The sequence of the sense strand of a mammalian gene is: TATAATACGCGCAATACAATCTA

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.