Biochem Background: Genetic profiling of tumors is increasingly used to guide cl

Question

Biochem

Background: Genetic profiling of tumors is increasingly used to guide clinical decisions. Tumors frequently have mutations in genes for tyrosine kinase receptors and associated MAPK signaling pathways. In some tumors the receptor itselfis mutated in others. proteins in the MAPK pathway. In 40% of malignant melanoma a mutated from of the Raf-1 protein BRAF is found. The majority of mutations are found within this amino acid sequence of wild-type BRAF Thr Val Lys Ser Arg Trp 599 604 Some of the mutations have the effect that BRAF becomes constitutively active, signaling unregulated growth and proliferation. Clinical case: In a surgical excision of a melanoma metastasis, gene profiling was performed by PCR and sequencing. The following sequence was detected CTACAGAGAAATCTCGATGGAG The equivalent sequence in normal tissue is CTACAGTGAAATCTCGATGGAG a) What is different? Briefly describe your observation. b) Identify the codons in the nucleotide sequence above that code for the amino acids 599 to 604 of the BRAF protein. Note: The first nucleotide in the above sequences does not necessarily coincide with the first nucleotide of a base triplet

Explanation / Answer

a)
The amino acid sequence detected in clinical case (1) and the equivalent sequence in normal tissue (2) are:

CTACAGAGAAATCTCGATGGAG ... (1)
CTACAGTGAAATCTCGATGGAG ... (2)

Comparing both these sequences, we can see that only one nucleotide T of the normal tissue has been replaced by A in the clinical case.

b.
Identifying the codons in the nucleotide sequence (2) of normal BRAF by comparing it with given amino acid sequence:
CT ACA  GTG  AAA  TCT  CGA  TGG AG
(Thr) (Val) (Lys) (Ser) (Arg) (Trp)

c.
Translating a nucleotide sequence of the mutated gene (1) into the amino acid sequence:

CT ACA  GAG  AAA  TCT  CGA  TGG AG
(Thr) (Glu)* (Lys) (Ser) (Arg) (Trp)

d.
Writing the sequence of the coding strand, template strand, m-RNA, and corresponding amino acid sequence,

For normal strand (2):

5' ... CTACAGTGAAATCTCGATGGAG ... 3' : (Coding strand)

3' ... GATGTCACTTTAGAGCTACCTC ... 5' : (Template strand)

5' ... CU ACA  GUG  AAA  UCU  CGA  UGG AG ... 3' : (mRNA)
(Thr) (Val) (Lys) (Ser) (Arg) (Trp) : (Corresponding amino acid sequence in protein)


For the strand from the clinical case (1):

5' ... CTACAGAGAAATCTCGATGGAG ... 3' : (Coding strand)

3' ... GATGTCTCTTTAGAGCTACCTC ... 5' : (Template strand)

5' ... CU ACA  GAG  AAA  UCU  CGA  UGG AG ... 3' : (mRNA)
  (Thr) (Glu)* (Lys) (Ser) (Arg) (Trp) : (Corresponding amino acid sequence in protein)

Related Questions

Navigate

• Browse (All)
• Browse B
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.