Question 37 of 40 Incorrect Incorrect Mapoob sapling learming Imagine that you d

Question

Question 37 of 40 Incorrect Incorrect Mapoob sapling learming Imagine that you discover three different bacterial species on a meteorite. Each species contains genetic material that is not DNA, but the genetic material of each species contains four bases. Each species has a different number of amino acids. Use the total number of amino acids per species to determine the minimum codon length for each species. Amino acids Codon length Number Species A Number Species B 47 Number Species C162 Tools x 102 - O Previous Give Up & View Solution O Check Answer 0 Next Exit - Hint

Explanation / Answer

1. species A : Total number codons 1

Species B: Total number codons 16

Species C: Total number codons 256

2.

5' CCATGCACCAGATCGCTTATTAAAT 3'

3' GGTACGTGGTCTAGCGAATAATTTA 5'

Only one ORF is present comprising of both start codon and stop codon.

3.

Nucleosides: Contain a base and a monosaccharide; do not contain a phosphate group; the product when a base bonds to carbon 1 of ribose or deoxyribose.

Nucleotides: Are the monomers of the nucleic acids; Contain a base, a monosaccharide and a phosphate group; can be named as Adenosine-5'- monophosphate; Are found in RNA and DNA

Both: may contain either a purine or pyrimidine.

Related Questions

Navigate

• Browse (All)
• Browse Q
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.