Assume that the following is the entire sequence of a short protein which did no

Question

Assume that the following is the entire sequence of a short protein which did not require mRNA splicing prior to its translation:

NH2-Met-His-Leu- Tyr-Ile-His-Cys-Trp-Gln-Lys-Phe-COOH

1. Write out the sequences of both strands of the double-stranded DNA molecule corresponding to the mRNA and protein. You only need to write the portion of the double-stranded DNA molecule which corresponds to the mRNA sequence in part (a). Label the template and non-template strands as well as 5’ / 3’ directionality.

2. Identify three bases in the DNA molecule, each of which, if mutated, will result in a nonsense mutation. Above each of these nucleotides, write the base which will result in a nonsense mutation.

Explanation / Answer

3'TACGTAAATATATAAGTAACAACCGTTTTCAAA5'

5'ATGCATTTATATATTCATTGTTGGCAAAAGTTT3'

UUA » mutation » UAA

UAU»mutation»UAG

UGU»mutation»UGA

Related Questions

Navigate

• Browse (All)
• Browse A
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.