A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment

Question

A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’.

A segment of DNA is cloned into a vector and then the vector DNA is denatured and subjected to dideoxy DNA sequencing via the traditional (nonfluorescent) method. Below is the DNA sequence from a region of the vector.

5’GGGCTAGCCGGATCCATGACTAGTCCGACTTACTGACCATCGACTCATCC-3’

3-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACTGGTAGCTGAGTAGG-5’

Based on the sequence above, what would be the sizes of the bands (i.e., the number of nucleotides in each band) in the lane in which dideoxyC had been added to the sequencing reaction?  

Explanation / Answer

25, 30,31,36,37,41

Related Questions

Navigate

• Browse (All)
• Browse A
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.