Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Suppose your chosen career path is to study the molecular genetics of the Bushma

ID: 65354 • Letter: S

Question

Suppose your chosen career path is to study the molecular genetics of the Bushmaster, a highly venomous tropical snake. Being an incredibly courageous scientist, you extract some cheek epithelial cells from a not-so-willing subject, perform restriction digests on the DNA isolated from these cells, and obtain a small region of sequence from one of this animal’s chromosomes. This sequence reads: 5’- gaatagtggaacaatgacagggagcacatgtaccagccaaagtgactccaagaagactggctaaaacttagcagcgtgccgc -3’

A) Using the genetic code, locate an open reading frame that spans the full length of this sequenced part of the chromosome (i.e. no stop codons). Below, write the amino acid sequence (in single-letter code) that is encoded by this open reading frame:

B) Next, go to http://www.ncbi.nlm.nih.gov and under “Popular Resources” click on BLAST, then click on protein blast. Find the large window beneath “Enter Query Sequence” and enter your amino acid sequence (single-letter code) in this window. For Database select Non-redundant protein sequences (nr). Be sure the Algorithm under Program Selection is blastp. Finally, hit the BLAST button at the bottom of the screen. The search should take mere seconds and will give you a final screen with colored bars, and below that a list of homologous proteins, and below that a series of protein-protein alignments. Write the name of the best human match (hint: it is a protein we have covered in class):    

Explanation / Answer

5’- Gaa tag tgg aac aat gac agg gag cac atg tac cag cca aag tga ctc caa gaa gac tgg cta aaa ctta gca gcg tgc cgc -3’

The amino acid sequence for the codon is -

Codon-- tgg aac aat gac agg gag cac atg tac cag cca aag

Amino acid sequence--Trp, Asn, Asn, Asp, Arg, Glu, His Met, Tyr, Gln, Pro, Lys,

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote