The nucleotide sequence below is from an individual. Only one strand of the chro

Question

The nucleotide sequence below is from an individual. Only one strand of the chromosome is shown. Write the complementary strand of the DNA below. Watch your polarity! Below are two sequences, A and B. Both of these sequences are from the same gene from two different individuals. Differences in their sequence are highlighted red. What do these two sequences (A and B) represent? Now predict what a DNA gel of digested DNA from individual A and B will look like. Draw in the DNA into the gel. The lanes of the gel are labeled for you. Assume individual A from above a "wild type" sequence. What type of mutation is seen in individual B?

Explanation / Answer

complementary sequences:

3'AGCTAGCTAGGAGGATCCCTTGACCTTGTCGTACTGGCTCGCTA 5'

2) single nucleotide polymorphisms

Related Questions

Navigate

• Browse (All)
• Browse T
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.