Using the codon table provided, fill in the missing entries in the following tab

Question

Using the codon table provided, fill in the missing entries in the following table. Assume that the reading frame is from left to right (and the start codon is not shown here, but exists upstream [to the left] of the sequence shown here) and that columns represent transcriptional and translational alignments. Each unfilled "white block" should have an answer indicated. Using the codon table provided, fill in the missing entries in the following table. Assume that the reading frame is from left to right (and the start codon is not shown here, but exists upstream [to the left] of the sequence shown here) and that columns represent transcriptional and translational alignments. Each unfilled "white block" should have an answer indicated. Given the following coding strand of DNA sequence, transcribe it into mRNA, showing the orientation of the mRNA [i.e. 3' and 5' ends]. Then translate this sequence into the correct protein based on your understanding of what defines a proper "reading frame".

Explanation / Answer

1.

2. From the coding strand given above in the question, the transcribed mRNA have the following sequence:

5' -GGGAUCGAUGCCCCUUAAAGAGUUUACAUAUUGCUGGAGGCGUUAACCCCGGA -3'

The translated sequence is as follows:

Gly-Ileu-Asp-Ala-Pro-Stop-Arg-Val-Tyr-Ileu-Cys-Trp-Arg-Arg-Stop-Pro-Arg-3'

5' OR 3' N U C L E O T I D E 5' or 3' Strand ID 3' C G T A C C A C T G C A 5' Non-coding DNA strand 5' G C A T G G T G A C G T 3' Coding DNA strand 5' G C A U G G U G A C G U 3' mRNA transcribed A l a T r p St o p A r g Amino acids incorporated into protein.

Related Questions

Navigate

• Browse (All)
• Browse U
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.