What is the longest polypeptide that can be encoded by the following RNA: 5-UAGU

Question

What is the longest polypeptide that can be encoded by the following RNA: 5-UAGUUUGAUGGGGCCCGAUGCAUAGGUUUAUACUAUUUAUCGGGUGA-3' 5 6 8 9 10 Which are all the polypeptides that can be encoded by this DNA: '-CGGAGAUGCUCAGAClJlJUAGGCCCCGAUGG(jC(iAAAGCAUCGGCUAAC-3' 3'-GCCUCUACGAGlJGUGAAAUCUGGGGCUACCCGCUUlJCGUAGCCGAUUG-5' met leu arg leu only met leu arg leu & met gly glu ser ile gly met leu arg leu & met gly glu ser ile gly & met leu ser pro ile gly val met gly glu ser ile gly only none of the above Rank the following mutations from least to worst effect on the polypeptide 5'- AUGCAUAGGUAUAUACUAlJUUAUCGGGUGA-3' 5'-AUGCAUAGGUAAAUACUAUUUAUCGGGUGA-3* 5'-AUGCAlJAGAUAUAUACUAUUUAUCGGGUGA-3' 5'- AU CAUAGGUAUAUACUAUUUAUCGGGUGA-3' 5'-AUG CAUAGGUAUAUACUAUUUAUCGGGUGA-3' 5'-AUGCAUAGGUAUfiUACUAUUUAUCGGGUGA-3* V, IV. HI. II .1 II. V. I. IV. Ill I. II. III. IV. V IV. 11,111. V. I II, V. HI. IV. I

Explanation / Answer

6)5

Protein synthetisis starts with AUG and terminate at UAG/UGAUAA

7)strand starts with 5'end involved in protein Synthesis

AUG-methionine

CUC -leu

AGA-arg

CUU-leu

So better option is a

8)b

Iii is more affected as no protein Synthesis take place

Related Questions

Navigate

• Browse (All)
• Browse W
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.