Genetic Code: Codon on mRNA and corresponding amino acid UUA Leucine UAA Nonsens

Question

Genetic Code:
Codon on mRNA and corresponding amino acid

UUA      Leucine                               UAA      Nonsense

GCA      Alanine                               AAU      Asparagine

AAG      Lysine                                 UGC      Cysteine

GUU      Valine                                 UCG       Serine

If the sequence of amino acids coded for by a strand of DNA is: alanine-valine-lysine-leucine-serine-serine-asparagine-leucine   what is the order of bases in the non coding strand of DNA?

Explanation / Answer

Genetic Code:
Codon on mRNA and corresponding amino acid

UUA Leucine UAA Nonsense

GCA Alanine AAU Asparagine

AAG Lysine UGC Cysteine

GUU Valine UCG Serine

If the sequence of amino acids coded for by a strand of DNA is: alanine-valine-lysine-leucine-serine-serine-asparagine-leucine what is the order of bases in the non coding strand of DNA?

In the sequence given, the mRNA sequence is (just write out the letters for Alanine, valine, etc.):

GCAGUUUUAUCGUCGAAUUUA

---This is the strand that has been coded from the DNA (mRNA). The other strand (the non-coding strand) is the template for this mRNA. Because of this, it will show complimentary pairing. Adenine binds to Thymine, Uracil to Adenine, and Guanine to Cytosine (sorry if I've mispelled some of those). From this, we can figure out the template for the mRNA given by determining the base pairing:


GCAGUUUUAUCGUCGAAUUUA <--mRNA given

CGTCAAAATAGCAGCTTAAAT <--DNA Template

Related Questions

Navigate

• Browse (All)
• Browse G
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.