Normal - ACAAAGGAAAACGAAAGAAATTGTCGAGGAGTC Mutant - ACAAAGGAAAACGAAATTGTCGAGGAGT

Question

Normal - ACAAAGGAAAACGAAAGAAATTGTCGAGGAGTC
Mutant - ACAAAGGAAAACGAAATTGTCGAGGAGTCAGAA

We can see that the mutant has experienced a deletion of the GAAA sequence, but since this is a four letter sequence that has been deleted, we call this deletion a frameshift mutation.
A frameshift deletion is very dangerous. For one, you are deleting an entire amino acid right off the bat, and following this, every other amino acid will more likely than not be changed into something else, making the amino acid chain product completely different where the mutation started. This will most likely be a knockout mutation (no more function).

Design a screen for the mutation present in patient described above to determine whether offspring of this individual will be affected with KTS Syndrome using PCR in your methodology.

Explanation / Answer

To know wether the offspring is affected with the KTS syndrome, the genetic mutation related to the syndrome should be known. If the same change is seen thenn the offspring will get the syndrome. KTS syndrome is due to the mutation in the AGGF1 gene. It is the Angiogenic Factor with G patch and FHA domains 1.

Related Questions

Navigate

• Browse (All)
• Browse N
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.