1) There is a point mutation is identified in the Factor V gene (c.1691G>A). Thi
ID: 80443 • Letter: 1
Question
1) There is a point mutation is identified in the Factor V gene (c.1691G>A). This point mutation predicts the synthesis of a Factor V molecule that cannot be properly inactivated by Activated protein C and that predisposes to a clotting condition called deep vein thrombosis. Design a sequencing assay to detect this point mutation. To obtain credit you must cite any references that you use including websites for primer design and explain your reasoning.
B. What results do you expect for each genotype?
C. What other type of assay could be used to detect this mutation?
2) Given the sequence below from a patient with metastatic melanoma:
Identify the gene and exon sequenced and if it is wild type or mutant. If mutant is there any clinical significance to the mutation –why or why not?
#5 forward sequence:
CTTACTACACCTCAGATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACARAGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTKTCTGGATCCATTTTGTGGATGGTAAGAATTGAGGCTATTTTTCCACTGATTAAATTTTTGGCCCTGAGATGCTGCGTCATAGCTGTTTC
#6 reverse sequence:
AGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGSACCCACTCCATCGAGATTTCWYTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGTAAAGGAAAACAGTAGATCTCATTTTCCTATCAGAGCAAGCACTGGCCGTCGTTTTACA
3) Identify the mutation in the following Sanger Sequencing traces: ref refers to reference sequence. Both forward and reverse sequencing are included.
az AAAAAAAs AAAAAAAA AAAA. AAAAAAAAAAAAAAAA EMn/AAAAAAAAAAAAAAAA revuExplanation / Answer
Hi, as per our regulations the first question is answered.
The mutation has occurred in a single nucleotide. These type of point mutations can be best detected using HRM ( High-resolution Melting) analysis. Here, using the qPCR the suspect DNA and wild-type DNA are melted to obtain their Tm values. The point mutation from G to A changes the hydrogen bonding pattern and changes the Tm. The wild type with G will have higher Tm compared to the mutant with A. This way the point mutation can be detected.
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.