11. The DNA sequence encoding the leader peptide of the trp operon was mutated a
ID: 80979 • Letter: 1
Question
11. The DNA sequence encoding the leader peptide of the trp operon was mutated as shown below. The wild-type and altered nucleotide is bolded for ease of identification ATGAAAGCAATTT CCGTACTGAAAG GTTGGTGGCGCACTTCCTGA wild type leader peptide coding sequence mutant leader peptide ATGAAAGCAATTT CCGTACTGAAAGGTGGGTGGCGCACTT CCTGA coding sequence What change in the control of trp operon expression is most likely to occur in E. coli cells containing the mutant leader peptide coding sequence compared to wild type A. The Trp repressor will bind more tightly to the trp operon in the mutant cells. B. The amount of attenuation will be reduced in the mutant. C. Negative control of the trp operon will be increased in the mutant. D. Open promoter complexes will form less often in the mutant.Explanation / Answer
Trp operon system controls the regulation of genes that involved in biosynthesis of tryptophan amino acid. It is first repressible system discovered in E. coli. When level of tryptophan amino acid is high in cells that leader sequence for loop like structure and inhibit the mRNA sysnthesis of structural gene. In this operon two main components are present:1) regulatory sequence and 2) structural sequence.
Regulatory sequence consists of repressor gene, promoter, operator and most important is leader sequenc (trp L). Whereas structural genes that responsible for enzyme that helps tryptophan synthesis.
Leader sequence plays crucial role in synthesis of structural gene mRNA. Explanations of answers are as follows:
A. Binding of trp repressor depend upon the concentration of tryptophan amino acid and repressor bind with operator region. So repressor is not playing any role in leader sequence.
B.Leader sequence mutant affect the loop formation process when level of tryptophan amino acid is high, therefore, they produce structural gene mRNA and translate them. (
C. Negative control of mutation will not increase because mutation affects the loop formation structure.
D. As mutation was in trp L sequence that is downstream to operator so it does not affect the operator function.
Nore :Answer B is correct in this question. But one possibility that should be consider some time deliberate mutation increase the loop formation process and that affect the structural gene synthesis. In that case answer C will be correct.
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.