Which of the following statements is correct regarding telomerase? A.) It extend

Question

Which of the following statements is correct regarding telomerase? A.) It extends the template strand of DNA. B.) It is a reverse transcriptase that contains its own DNA template. C.) It leads to a progressive loss of DNA from the ends of chromosomes. D.) It involves a primase enzyme which is a subunit of the telomerase.

Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC A.) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code. B.) There would be a missense mutation, resulting in the substitution of an Asn for a His residue in the protein. C.) There would be a nonsense mutation, resulting in the synthesis of a truncated protein. D.) Both B and C are possible outcomes.

Explanation / Answer

Answer:

1) Which of the following statements is correct regarding telomerase?

A.) It extends the template strand of DNA.

B.) It is a reverse transcriptase that contains its own DNA template - Incorrect (it carries its own RNA template)

C.) It leads to a progressive loss of DNA from the ends of chromosomes - Incorrect (it prevents loss of DNA from the ends of chromosomes)

D.) It involves a primase enzyme which is a subunit of the telomerase - Incorrect, Primase is not a subunit of Telomerase.

2) Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC

A.) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code - Correct Answer: both ACC and ACT codes for Threonine. so even if the codon mutates to T from C, the amino acid it codes for remains unchanged.

B.) There would be a missense mutation, resulting in the substitution of an Asn for a His residue in the protein.

C.) There would be a nonsense mutation, resulting in the synthesis of a truncated protein.

D.) Both B and C are possible outcomes.

Related Questions

Navigate

• Browse (All)
• Browse W
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.