Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

The following DNA sequence represents a eukaryotic gene. Indicate which is the t

ID: 87970 • Letter: T

Question

The following DNA sequence represents a eukaryotic gene. Indicate which is the template and which is the coding strand, determine where transcription begins (assume it ends at the end of the sequence presented), and write out the nucleotide sequence of the initial transcript. You need to process the initial transcript to make an mRNA (there is an intron in the gene: using the information about splicing on pp. 306-307 of your textbook, locate and remove the intron) and write out the sequence of the completely processed mRNA. Finally, translate the mRNA and write out the amino acid sequence of the encoded polypeptide. 5'- ACCGGCCTCTCTCTCACACACAGTACGGCGTTTATTGGGACTTCAAATCATAT GGCCATTACAAGCCCTGCAGAAAGGGAAGGCGAAGCTCAGGATAAGTA... 3 ' - TGGCCGGAGAGAGAGTGTGTGTCATGCCGCAAATAACCCTGAAGTTTAGTATA CCGGTAATGTTCGGGACGTCTTTCCCTTCCGCTTCGAGTCCTATTCAT... ..CAGGTGACACTCTACTCACCGGATAAGTATTGTCATCTCCCAAGGGGGTGAATATCCGCGCATCCGCTTTATATCGCCTGATTAACGCAGTCCTACACAAT- 3' ..GTCCACTGTGAGATGAGTGGCCTATTCATAACAGTAGAGGGTTCCCCCACTTATAGGCGCGTAGGCGAAATATAGCGGACTAATTGCGTCAGGATGTGTTA- 5'

Explanation / Answer

Template strand is the DNA strand which acts as a template for the RNA synthesis. RNA polymerase acts on this strand from 3' to 5' end.

Template strand --------------> 3' -TGGCCG.....GTGTTA -5'

Coding strand determines the sequence of RNA. RNA contains uracil insted of thymine. It is read from 5' to 3' end.

Coding strand -----------------> 5' -ACCGGC....CACAAT -3'

In eukaryotic gene, transcription begins 10 base pairs downstream of promotor region. The promotor region is recognised by the presence of TATA box in coding strand.

Nucleotide sequence of the initial transcript is 5'-AACGCAGUCCUACACAAU-3'

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote