The DNA molecule whose entire sequence is given below is digested to completion

Question

The DNA molecule whose entire sequence is given below is digested to completion with the enzyme EcoRI (5' G^AATTC 3') How many molecules of DNA would result from this reaction? Write out the entire sequence(s) of the resultant DNA molecule(s), indicating all relevant 5'-to-3' polarities. What about this problem appears unusual (though by no means impossible) in relationship to DNA made of random nucleotide sequences? 5' AGATGAATTCGCTGAAGAACCAAGAATTCGATT 3' 3' TCTACTTAAGCGACTTCTTGGTTCTTAAGCTAA 5'

Explanation / Answer

The restriction digestion will yield three molecules of DNA, as there are two restriction sites in the mentioned DNA sequence.

Related Questions

Navigate

• Browse (All)
• Browse T
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.