Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Following is the DNA template strand of a small prokaryotic gene to be transcrib

ID: 91753 • Letter: F

Question

Following is the DNA template strand of a small prokaryotic gene to be transcribed (assume this is the entire gene). Numbers above the sequence are for questions C, D, & E): Answer what you can, thanks!

3' TTCTACAGAGTTATATCCACTGAG 5'

A. Write out the nucleotide sequence of the mRNA that will be produced by transcription of this gene.

B. Write out the amino acid sequence of the polypeptide produced by translation of this mRNA.

C. If the "A" nucleotide underneath the number 1 was mutated and changed to a "C" nucleotide, indicate what kind of mutation this would be. Explain your answer.

D. If the "C" nucleotide underneath number 2 was mutated and changed to a "T" nucleotide, indicate what kind of mutation this would be. Explain your answer.

E. If the "T" nucleotide underneath number 3 was mutated and changed to a "G" nucleotide, indicate what kind of mutation this would be. Explain

Thanks!

Explanation / Answer

'

As given,

3'TTCTACAGAGTTATATCCACTGAG5'

When the sequence is transcripted into mRNA sequence the the sequence of the nucleotides would be;

5'AAGAUGUCUCAAUAUAGGUGACUC3'

B. The nucleotides are in the form of a triplet codon in the mRNA. The polyoeptide chain formation will start whwreevwr the start codon (AUG)is present. ane ends wherever the stop codons (UAA/UAG/UGA) are present. The regions before the start codons at the 5' end and the regions beyond the stop xodon at 3' end are the untranslated regions or UTRs

Therefore the possible polypeptide sequence would be;

5'(UTR)-Met(start)-Ser-Gln-Tyr-Arg-STOP-(UTR)3'

Well i think you should have mentioned the numbers above the sequence on which mutations are supposed to occur. Because I won't be able to mutate the sequence without prior numbering of the sequence.

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote