The restriction enzyme BamHI recognizes the sequence 5\' G/GATCC-3\' and cuts be

Question

The restriction enzyme BamHI recognizes the sequence 5' G/GATCC-3' and cuts between the two G's, as indicated by the '/' in the sequence. How many DNA fragments (pieces) will result from cutting the strand of DNA below with BamHI? Will these fragments have sticky or blunt ends? 5' ACCTAGGTATGGAATCCGCGCCTAGGTTTGGATCCATATAGGATCCCCGA-3' 3' -TGGATCCATACCTAGGCGCGGATTCCAAACCTAGGTATATCCTAGGGGCT -5' A. Two fragments, sticky ends B. Three fragments, sticky ends C. Three fragments, blunt ends D. Four fragments, sticky ends E. Four fragments, blunt ends You are purifying a protein with a pl of 5.31 and you are using a purification buffer of pH 7.5. Your protein does not contain a His-tag. What will be the overall charge on your protein and which column would be best to ensure that your protein binds? A. Negative, anion exchange B. Negative, cation exchange C. Positive, anion exchange D. Positive, cation exchange E. Nickel column (Dr. Acevedo) Which of the following is NOT required for transcription (DNA rightarrow RNA)? A. Primase B. Helicase C. DdRp D. Ligase E. DNA template

Explanation / Answer

3.b. three fragments , sticky ends.

4.negative,cation exchange.

5.d. ligase. this enzyme joins the DNA fragments and plays a role in replication.

Related Questions

Navigate

• Browse (All)
• Browse T
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.