Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Browse Y

Alphabetical listing with fast deep pagination.
29588 items • Page 425 / 592

All 0-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
You volunteer some of your spare time to your local fire department and have bee
You volunteer some of your spare time to your local fire department and have been asked by an assistant chief to analyze data on firefighters who applied for promotion. The assist…
You volunteer some of your spare time to your local fire department and have bee
You volunteer some of your spare time to your local fire department and have been asked by an assistant chief to analyze data on firefighters who applied for promotion. The assist…
You volunteer some of your spare time to your local fire department and have bee
You volunteer some of your spare time to your local fire department and have been asked by an assistant chief to analyze data on firefighters who applied for promotion. The assist…
You volunteer some of your spare time to your local fire department and have bee
You volunteer some of your spare time to your local fire department and have been asked by an assistant chief to analyze data on firefighters who applied for promotion. The assist…
You volunteer some of your spare time to your local fire department and have bee
You volunteer some of your spare time to your local fire department and have been asked by an assistant chief to analyze data on firefighters who applied for promotion. The assist…
You volunteer some of your spare time to your local fire department and have bee
You volunteer some of your spare time to your local fire department and have been asked by an assistant chief to analyze data on firefighters who applied for promotion. The assist…
You volunteer some of your spare time to your local fire department and have bee
You volunteer some of your spare time to your local fire department and have been asked by an assistant chief to analyze data on firefighters who applied for promotion. The assist…
You volunteer with a nonprofit organization that works to connect low income pop
You volunteer with a nonprofit organization that works to connect low income populations with health care resources. The volunteer coordinator expressed an intrest in determining …
You volunteered for the first time for the walk to end alzheimer, you helped set
You volunteered for the first time for the walk to end alzheimer, you helped setting up the registration stations and photo boots then directed the people for the walk. In 300 wor…
You wake up one morning and find yourself in a room with Ren and Stimpy. You are
You wake up one morning and find yourself in a room with Ren and Stimpy. You are not sure how you got there but that is irrelevant for the problem. Ren and Stimpy each have an all…
You wake up one morning to find yourself in a strange room with opaque walls, an
You wake up one morning to find yourself in a strange room with opaque walls, and no visible doors or windows. You’re immediately aware that the local gravity feels different from…
You wake up one morning to find yourself in a strange room with opaque walls, an
You wake up one morning to find yourself in a strange room with opaque walls, and no visible doors or windows. Clearly you’ve been abducted in your sleep! You’re immediately aware…
You wake up one morning to find yourself in a strange room with opaque walls, an
You wake up one morning to find yourself in a strange room with opaque walls, and no visible doors or windows. Clearly you’ve been abducted in your sleep! You’re immediately aware…
You wake up one night to find some small bats drinking your blood and peeing on
You wake up one night to find some small bats drinking your blood and peeing on you. Assuming that you live in Colorado at high elevation, which of the following would you expect …
You walk barefoot in your house and cross from the carpeted living room to the t
You walk barefoot in your house and cross from the carpeted living room to the tiled-floor kitchen. The tile floor always feels warmer than the carpet. warmer than the carpet in s…
You walk barefoot in your house and cross from the carpeted living room to the t
You walk barefoot in your house and cross from the carpeted living room to the tiled-floor kitchen. The tile floor always feels warmer than the carpet. warmer than the carpet in s…
You walk by a tube sticking out of the ground. You do not know if the bottom end
You walk by a tube sticking out of the ground. You do not know if the bottom end of the tube is open or closed. However you are trained in voice and you find that there are standi…
You walk by a tube sticking out of the ground. You do not know if the bottom end
You walk by a tube sticking out of the ground. You do not know if the bottom end of the tube is open or closed. However you are trained in voice and you find that there are standi…
You walk into the birthing center at the beginning of your shift and look at the
You walk into the birthing center at the beginning of your shift and look at the listing of clients who are in the birthing area. The list looks like this: Name GP Gestation Dilat…
You walk into what looks like an ordinary elevator, holding your bathroom scale
You walk into what looks like an ordinary elevator, holding your bathroom scale (as you do every morning), and press a random button. However, you should never have assumed that a…
You walk into your home and decide to turn on the fan to cool down. After 3.5 s,
You walk into your home and decide to turn on the fan to cool down. After 3.5 s, it reaches a max speed where each blade of length l = 10in makes a complete rotation every 0.5s. C…
You walk into your home and decide to turn on the fan to cool down. After 3.5 s,
You walk into your home and decide to turn on the fan to cool down. After 3.5 s, it reaches a max speed where each blade of length l = 10in makes a complete rotation every 0.5s. C…
You walk to Stevens Way and wait for a bus. Instead of getting on the bus, you r
You walk to Stevens Way and wait for a bus. Instead of getting on the bus, you record your waiting time Ti. You repeat this for a total of 50 buses, obtaining T2... Tso. Assume th…
You want Internet connection for your office. You go to a phonecompany to find o
You want Internet connection for your office. You go to a phonecompany to find out the cost of providing Internet connection. They say that if you have up to 10 users in your offi…
You want a mountain cabin built for weekend trips, vacations, to host family, an
You want a mountain cabin built for weekend trips, vacations, to host family, and perhaps eventually to retire in. After discussing the project with a local contractor, you receiv…
You want a program that can take 2 dates represented by (m1, d1, y1) and (m2, d2
You want a program that can take 2 dates represented by (m1, d1, y1) and (m2, d2, y2) Note that m1 and m2 are month numbers (1-12) , d1 and d2 are days in the month, and y1 and y2…
You want see for yourself how mRNA behaves in a eukaryotic cell. You add radioac
You want see for yourself how mRNA behaves in a eukaryotic cell. You add radioactive UTP to the cell medium in two separate dishes. After a short amount of time, you add a large e…
You want the current amplitude through a inductor with an inductance of 5.00 m H
You want the current amplitude through a inductor with an inductance of 5.00mH (part of the circuitry for a radio receiver) to be 2.70mA when a sinusoidal voltage with an amplitud…
You want to accumulate $1 million by your retirement date, which is 25 years fro
You want to accumulate $1 million by your retirement date, which is 25 years from now. You will make 25 deposits in your bank, with the first occurring today. The bank pays 8% int…
You want to add D-methionine to liquid cultures of E. coli that you have grown o
You want to add D-methionine to liquid cultures of E. coli that you have grown overnight to see if this unusual amino acid affects the growth rate of bacteria. To test this, you m…
You want to add D-methionine to liquid cultures of E. coli that you have grown o
You want to add D-methionine to liquid cultures of E. coli that you have grown overnight to see if this unusual amino acid affects the growth rate of the bacteria. To test this, y…
You want to add a new Product and Services entry to your client’s QuickBooks Onl
You want to add a new Product and Services entry to your client’s QuickBooks Online company. The service is installation of a server but doesn’t include the cost of the hardware. …
You want to add an additional stock to your portfolio and are considering two al
You want to add an additional stock to your portfolio and are considering two alternatives. For stock A, the expected return is 14.20% and the beta is 1.62. For stock B, the expec…
You want to amplify a 2.1 kb portion of your favorite gene from genomic DNA usin
You want to amplify a 2.1 kb portion of your favorite gene from genomic DNA using PCR.  The sequence of the two ends of the coding strand is as follows: 5’- CTCCATGGTAAACTTGTACT .…
You want to amplify a 2.1 kb portion of your favorite gene from genomic DNA usin
You want to amplify a 2.1 kb portion of your favorite gene from genomic DNA using PCR.  The sequence of the two ends of the coding strand is as follows: 5’- CTCCATGGTAAACTTGTACT .…
You want to amplify a 21,666 bp-long fragement of human DNA using PCR. You desig
You want to amplify a 21,666 bp-long fragement of human DNA using PCR. You design a pair of primers that are 21 and 23 bases in length (respectively), have identical melting tempe…
You want to amplify a specific DNA sequence from an influenza virus. Which of th
You want to amplify a specific DNA sequence from an influenza virus. Which of the following is necessary for the amplification of this DNA by PCR but not necessary for amplificati…
You want to amplify the DNA between the stretch of sequence shown in the figure
You want to amplify the DNA between the stretch of sequence shown in the figure below. Of the listed primers chose the pair that will allow you to amplify the DNA by PCR. A. Forwa…
You want to amplify the sequence below using PCR. The sequence shown in red repr
You want to amplify the sequence below using PCR. The sequence shown in red represents the sequence that MUST be included in the amplified product, though any flanking sequence is…
You want to analyse for the case where v_s is a DC source (constant voltage), R
You want to analyse for the case where v_s is a DC source (constant voltage), R = 20000 ohm, L = 0.01 H, C = 5 times 10^-5 F. a) Show that the above circuit can be modelled as the…
You want to analyze DNA samples on an agarose gel. Before loading the sample int
You want to analyze DNA samples on an agarose gel. Before loading the sample into the gel, you need to add loading buffer. The concentration of the stock loading buffer (LB) is 6X…
You want to analyze a cadmium nitrate solution. What mass of NaoH s to precipeat
You want to analyze a cadmium nitrate solution. What mass of NaoH s to precipeate the cd ions from 35.3 mL of o 493 M cd(Nos2 solution? needed Periodic Table Fundamental My Notes …
You want to analyze a core sample containing oil, water and gas. Bulk volume of
You want to analyze a core sample containing oil, water and gas. Bulk volume of sample was 95 Cm^3 and its initial weight was 216.7 gin. Sample was evacuated and gas space was sat…
You want to apply 50 lbs N per acre and 10 lb P2O5 per acre to a 123 acre potato
You want to apply 50 lbs N per acre and 10 lb P2O5 per acre to a 123 acre potato field. You will be using fertigation. The center pivot irrigation system you are working at can co…
You want to artificially produce an enzyme, protein A, through genetic-engineeri
You want to artificially produce an enzyme, protein A, through genetic-engineering. Although you can get your "engineered" bacteria to produce large quantities of A, the product i…
You want to artificially produce an enzyme, protein A. through genetic-engineeri
You want to artificially produce an enzyme, protein A. through genetic-engineering. Although can get your "engineered" bacteria to produce large quantities of A, the product is in…
You want to assess the graft rejection capacity of different MHC molecules in fe
You want to assess the graft rejection capacity of different MHC molecules in female mice. You plan to use 5 mouse strains (S1-S5), which are genetically identical except various …
You want to bake cupcakes for your instructor! You need a recipe and get the ing
You want to bake cupcakes for your instructor! You need a recipe and get the ingredients ready. The butter and eggs came from the refrigerator, and the dry ingredients are at room…
You want to be a Microbiologist! you want to develop a career as a microbiologis
You want to be a Microbiologist! you want to develop a career as a microbiologist. What aspect/topic of microbiology would you choose to study? What would you like to research, de…
You want to be a millionaire when you retire in 35 years. How much do you have t
You want to be a millionaire when you retire in 35 years. How much do you have to save each month if you can earn an annual return of 10.6 percent? (Do not round intermediate calc…