\'ged from a common ancestor, ie. wh\'er, speciation occurred ONA Comparison Exe

Question

'ged from a common ancestor, ie. wh'er, speciation occurred ONA Comparison Exercise in the following exercise genus Homo to the DNA sequence of their common ancestor which ones are more closely related and how that will translate into a phylogenetic tree. Write down the complementary sequence of the following three Homo sp. DNA sequences compare them to Austrolopithecus DNA to find pairs of mismatched nucleotides. Australopithecus, in order to determine and then ee will compare short 21-bp long DNA sequences of different species from The more mismatched pairs of nucleotides you find, the more different these DN A sequences are, meaning these species will be less closely related and further away from each other on the phylogenetic tree. . Homo sopiens DNA: 5' AGGCATAAACCAACCGATTAT 3 2. Homo habilis DNA: 5 AGGCCCCTTCCAACCAGGCCT 3 3. Homo erectus DNA: AGGCCCCTTCCAACCGATTAT 3 4. Australopithecus DNA: 5 AGGCCGGCTCCAACCAGGCCT 3 For example Australopithecus DNA: 5' AGGCCGGCTC CAACCAGGCCT 3 Homo sp. comp. DNA: 3' TC CGGCGAAGGCGGGTCCGTA 5 Haresapen Homo

Explanation / Answer

Taxon A = homo habilis

texton B = homogeneous erectus

Texan C = homo Sapiens

lower common and sister is Australiopithecus.

1- homo habilis is outgroup

2- bottom box represents the common ancestor Australiopithacus.

Related Questions

Navigate

• Browse (All)
• Browse #
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.