In a rare pea plant species the length of the stem is the result of the expressi
ID: 10908 • Letter: I
Question
In a rare pea plant species the length of the stem is the result of the expression of the gene “T”, the allele “T” codes for long stems while the allele “t” codes for short stems. In this same species the gene “G” code for the color of the seeds, the allele “G” codes for green and the allele “g” codes for brown.1-What are the genotypes of a filial generation when the genotypes of their parents are TTGG and TtGg? Report the result in percentages.
2-What are the phenotypes of the filial generation above? Report the result in percentages.
3-According to the genotypes of the filial generation and the gene sequences provided below determine the sequences of the proteins made by plants of this filial generation and report the percentages of plants that express each protein.
The sequences of the antisense strands of the different alleles for genes “T” and “G” are listed below.
T: AACTCTGTATGCTACCCCTAATGTTCGCACGGGACATTTG…
t: AACTCTGTATGATGATGCTACCCCTATTCGCACGGGACAT…
G:AATTAACCGGATGATGGCCATGGGCCGGCCGGATGG…
g:AATTAACTGGATGCGCGCGCGCCCCCGCGCGCGCGC…
Explanation / Answer
You would make a Punnet square for the first two parts of the question, in this case, with two traits, it would be a dihibrid cross. First you need to foil (first outer inner last, think like foiling in math) each parents alleles to get there gamete possibilities. the gametes for parent one are TG,TG,TG,TG the gametes for parent two are TG,Tg,tG,tg you can now do the dihybrid cross and get the following genotypes 25% or 4 are TTGG 25% are TTGg 25% are TtGG 25% are TtGg their phenotypes: 16 or 100% are both long stem and green because they have at least one "T" and one "G", the dominant alleles part three i am not sure about. sorry but this is correct for the first two parts
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.