sare made by RNA polymerase 1 in eukaryotes? A. snRNA B. tRNA C. 5S rRNA D. 185
ID: 148528 • Letter: S
Question
sare made by RNA polymerase 1 in eukaryotes? A. snRNA B. tRNA C. 5S rRNA D. 185 rRNA 39. What do both the rho-dependent rho-independernt A Terminate transcription immediately after the stop codon ependent and rho-independent mechanisms of termination have in common? B. A sequence rich with A-U base pairs C. Both require a helicase D. Formation of a stem-loop structure to separate the DNA-RNA complex erminal domain (CTD)? 40. What is the purpose of phosphorylating the carboxy t A. Convert from initiation to the elongation stage B. To stabilize the closed complex C. Phosphorylate transcription factors D. More than one above sequence of a structural gene. The first two bases of the transcript are 5 AG 3 5, ATTGACATGATAGAAGCACTGTTACTAAAATCTCAATAGTACGTATITETACGGATG 3 3' ATCACATAACTGTACTATCTTCGTGACAATGATTTTAGAGTTATO A. Label the most likely transcriptional start site. B. Is this a promoter from a eukaryote or a prokaryote? How can you tell?Explanation / Answer
Q:41:--Transcription :-- Synthesis of mRAN from GENOMIC DNA for production of amino acid outside the nucleus. This phenomenon is known as Transcription
A):--Now come to the point:--
Now most transcription site will be 'ATA' or 'ATG' in 3' to 5' strand of DNA. Why because we know that first codon that synthesizes Amino acid named methionine.
For methionine code will be TAT or ATG. So we can label from these sites in 3'to5' direction.
B):-- Eukaryotic promoter is with 'TATA' box which you can see in DNA sequence above as in 'TAAAAAAAAAAT'. OKAY, This is from Eukaryotic.
C).:-- Direction will be in towards of Right. Now Why?
As we know that transcript is synthesized over 3' to 5' direction but in the direction of 5'to3' direction means coding is just like opposite strand (5'to3') in given sequence. That will be Right.
D):-- Temperate strand:-- Strand of 3' to 5' from which mRNA is synthesized. But
Coding strand:-- 5' to 3' strand is known as coding strand because mRNA coding will be just like this one.
Okay
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.