NOTE: Make sure you answer ALL parts of this question. The score obtained from D
ID: 151562 • Letter: N
Question
NOTE: Make sure you answer ALL parts of this question.
The score obtained from DNA alignments depends on the scoring scheme that is used. The following example alignment is between paralogous genes.
QUERY: GCAGCGATGGTCCATGTTATATAGC
||| |||| | ||||| |||||
SUBJT: GCAACGATACT-GATGTTTTATAGG
What are paralogous genes? (1 mark)
What is the maximum word size that could be used to seed this alignment? Why? (2 marks)
What score would this alignment receive using the following hypothetical scoring system? (1 mark)
Matches = +4; Mismatches = -3; Gaps = -1
Explanation / Answer
1) Paralogous genes are homologous genes that have evolved by duplication and code for protein with similar, but not identical functions.
Example of paralogous genes- Mouse Alpha globin, mouse beta globin is both paralogs for each other.
--------------
2) Words size should be less than half of short query length sequences otherwise reliable hits will be missed. Word size is important because short word size will give more hits but more fragmented. Large word size will give lesser hits as it requires longer continuous match.
Maximum word size should be 12 as query sequence length is 25.
------------
Score= 18x 4= +72
No. of mismatches= 6
Score= 6x (-3) = -18
No. of gaps = 1
Score= -1
----
Total score = 72- 18 -1 =53
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.