Question 10 of 12 Sapling Learning A DNA fragment was sequenced using dideoxy DN

Question

Question 10 of 12 Sapling Learning A DNA fragment was sequenced using dideoxy DNA sequencing. In this procedure, ddATP was tagged with a green dye, ddCTP was tagged with a blue dye, ddGTP was t with a yellow dye, and ddTTP was tagged with a red dye. The primer used had the sequence 5-GACTC-3. Given the gel electrophoresis representation shown below, what was the sequence of the DNA fragment (template strand)? Step 1: The nucleotide sequence of the newly synthesized DNA is 3-CGCTATCTTTTccGG-5 Step 2: The nucleotide sequence, including the primer, is 3-CGCTATCTTTTccGGCTCAG 5 Step 3: write the complementary (template) nucleotide sequence. previous ove up sv s alien check Answer ONext Exi

Explanation / Answer

5'GCGATAGAAAAGGCCGAGTC3'

NOTE- the complemantary sequence involve complemantary base paring of nucleotide . The template strand will have complemantary nucleotide of that of coding strand, the A will pair with T, G will pair with C and vice versa this the two strands are complematary to each other.

Related Questions

Navigate

• Browse (All)
• Browse Q
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.