You ordered an oligonucleotide primer (GCGTGGATCCATGTTTGCGG) from a company name

Question

You ordered an oligonucleotide primer (GCGTGGATCCATGTTTGCGG) from a company named Invitrogen-Life Technologies. The company provides you with the oligonucleotide in a lyophilized (dried) powder form. They tell you that they have sent you a total of 63,000 pmol of purified oligonucleotide that weighs 606 ug. What volume of buffer would you resuspend the oligonucleotide powder in order to make a 1mM stock solution?

Hint: You are given more information than you need to answer his question. Also, think of the oligonucleotide as any reagent (e.g. NaCL of Tris buffer); don't get caught up with being a different kind of reagent than you have worked with before.

Explanation / Answer

need to add 63ul of nuclease free water to the dry powder received from Invitrogen-Life Technologies in order to get 1mM concentration of reconstituted oligonucleotide concentration.

Related Questions

Navigate

• Browse (All)
• Browse Y
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.