Need help with parts a-c as well as the question below c Question 2 Below is the
ID: 183853 • Letter: N
Question
Need help with parts a-c as well as the question below c Question 2 Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS) after the promoter (shown in yellow), and proceeds in the direction of the arrow. Transcription stops at the end of the Transcription Terminator (shown in blue). TSS AGCCATGCATTATCTAGATAGTAGGCTCTGAGAATTTATCTCACT-3 CTCGGTACGTAATAGATCTATCATCCGAGACTCTTAAATAGAGTGA-5 promoter terminator a) Which strand of DNA shown, the top or the bottom, is the template strand? b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA in (b)? Label the N and C termini. If a mutation were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in bold, what would be the sequence of the mRNA? What would be the sequence of the protein?Explanation / Answer
All strands are synthesize from 5' to 3' direction for both DNA (replication) and RNA (transcription).
In the figure,
a) The bottom strand of the DNA acts as template strand (anti-codon) and the top strand is the coding strand.
b) Sequence of mRNA 5'GAGCCAUGCAUUAUCUAGAUAGUAGGCUCUGAGAAUUUAUCUC3'
c) The protein produced from the mRNA (b)- N-EPCII*IVGSENLS-C-
The DNA sequence given start from TSS (arrow mark) to end of termination (blue) is not multiple of three, hence one extra nuclectide has been added in the given figure.
The last anwer is not clear, its T/A insertion after T/A (bold), if insertion occur than it going to be framshift mutation. kindly provide proper information of the last sentance in the question.
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.