The answers to b. c. and d. are wrong. B should be the mRNA sequence of the orig
ID: 189397 • Letter: T
Question
The answers to b. c. and d. are wrong. B should be the mRNA sequence of the original coding sequence, not the template sequence in answer A. I'm stuck and I need help!
To complete this activity points assignment,fill ut the following worksheet You should evi NA coding vs. DNA template sequence and how it relates to mRNA. You can use your amino acid chart from the PowerPoint lecture to complete this worksheet. Consider the following coding sequence of DNA: 5'-CTCCATGATAGGCAACTCGGATCCCTGACGC-3 a. Write out the template sequence, indicating directionality. b. Write out the mRNA sequence, indicating directionality. Write out the amino acid sequence, indicating directionality c. Thr d. What is the anti-codon that will recognize the third codon in this sequence?Explanation / Answer
coding sequence will be same as the RNA except the thymine replaced by uracil.
Coding:5'CTCCATGATAGGCAACTCGGATCCCTGACGC3'
a)Template:3'GAGGTACTATCCGTTGAGCCTAGGGACTGCG 5' (RNApolymerase read template from 3'-5' and make the RNA in 5'-3' direction)
b)mRNA : 5'CUC CAU GAU AGG CAA GUC GGA UCC CUG ACGC3' Ribosomes scan the mRNA from the 5' end to form the Nterminus of the protein to the 3' end which becomes the C terminous
c)AMINO ACID : N terminal Leu-His-Asp-Arg-Gln-Val-Gly-Ser-Leu-Thr Cterminal
d) anticodon is the DNA sequence that is complementary to the RNA produced. 3rd codon=5'GAU3' so the anticodon is the DNA sequence complementary to this that is 3'CTA5'.
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.