a hemoglobin with an abnormal electrophoretic mobility is detected in a screenin
ID: 190535 • Letter: A
Question
a hemoglobin with an abnormal electrophoretic mobility is detected in a screening program. Fingerprinting after the tryptic digestion reveals that the amino acid substitution is in the b chain. The normal amino-terminal (digested with trypsin) peptide (Val-His-Leu-Thr-Pro-Glu-Glu-Lys) is missing. A new tryptic peptide consisting of six amino acid terminal residue of this peptide.
a. Which amino acid substitutions are consistent with these data?
b. Which single base changes in DNA sequence could give these amino acid substitutions? The DNA sequence encoding the normal amino terminal region is GTGCACCTGACTCCTGAGGAGAAG.
c. How should the electrophoretic mobility of the abnormal hemoglobin compare with those of Hb A at pH 8 (would it move quicker or slower to the anode)?
Explanation / Answer
Trypsin cleaves at the carboxy terminal of Lys or Arg.
Given peptide sequence = Val-His-Leu-Thr-Pro-Glu-Glu-Lys
If Lys is mutated to some other amino acid, the N-terminal peptide would not be produced by tryptic digestion.
Given DNA sequence in WT = GTGCACCTGACTCCTGAGGAGAAG
AAG codes for Lys which is a positively charged amino acid.
GAG codes for Glu which is a negatively charged amino acid.
So, single base change at the first position of the AAG codon would result in the production of a protein that shows altered electrophoretic mobility due to altered charge. Glu has more negative charge. So, it would move quickly towards the positive electrode (Anode).
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.