s of a particular locus (note: r, for convenience, only one of e two strands of

Question

s of a particular locus (note: r, for convenience, only one of e two strands of DNA is shown You have identified the following two allele below for each case): [answer yes/no for each] the DNA in your sample is double standec ; howeve 5' GCTACTGGCCATTATCATACGGTCGCIATGCATTGACCGTATTG 3' 5' GCTACTGGCCATTATCATACTGTCGCTATGCATTGACCGTATTG 3' Which of the following oligos could potentially be used in the ASO technique to genotype individuals who carry either or both of these alleles? 5' GCATAGCGACAGTATGATAAT 3 5' GCATAGCGACCGTATGATAAT 3 5' GCTACTGGCCATTATCATACT 3 5' GCTACTGGCCATTATCATACG 5' GCTACTGGCCATTATCATAC 3' 3 ATTATCATACGGTCGCTATGC 3 5' CAATACGGTCAATGCATAGCGAC 3 ATTATCATACTGTCGCTATGC 3 5' CAATACGGTCAATGCATAGCGACA 3' 5' CAATACGGTCAATGCATAGCGACC 3' Submit Answer Tries 0/99

Explanation / Answer

1. NO

2. NO

3. NO

4. NO

5. NO

6. NO

7. YES

8. NO

9. YES

10. YES

ASO is Allele Specific Oligonucleotide, which is a synthetic DNA probe of 15-21 nucleotides and complementary to the target DNA sequence. So the oligos those could be potentially used in ASO technique to genotype individuals who carry either or both of these above alleles must be complementary in sequence to these alleles. Here among 10 oligos only three are perfect, as their sequences are complementary to the 3' end of those alleles.

Related Questions

Navigate

• Browse (All)
• Browse S
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.