What primers (forward and backward) are needed to amplify the gene \"x\" in ques

Question

What primers (forward and backward) are needed to amplify the gene "x" in question?

in the organism? Why? 6) You wish to amplify gene X from the chromosome shown below. Provide the sequence of the primers you would use (forward and reverse) and list what has to be in the test tube in order to carry out a PCR 5' ACGTCGATCCTACTATTGCATC GENE X CGTCGATCAACTGATTCAGGATC3 2 pts What is the sequence of your forward primer? 5'- What is the sequence of your reverse primer? 5 What components need to be in the tube to carry out a PCR when put into a thermocycler? 2 pts 6 pts 7) Identify the product of transcription for the gene in the following DNA sequence and write it below

Explanation / Answer

1) forward - 5'- ACGTCGATCCTACTATTGCATC-3'

2) reverse - 5'-GATCCTGAATCAGTTGATCGA-3'

3) you need a Pcr buffer, Mgcl2, dNTPs, forward primer, reverse primer, template and taq polymerase...

Related Questions

Navigate

• Browse (All)
• Browse W
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.