g) You become highly ambitious at work and unfortunately you contaminate the E.
ID: 196075 • Letter: G
Question
g) You become highly ambitious at work and unfortunately you contaminate the E. palapyensis with E. gaboronensis. Because you have worked with the strains for long enough, you know that the two strains differ in a few bases on the promoter sequence as below: E. gaboronensis: CAGATACCATGGCTAAAAAGAAAATTCTGGCCGATTTTAGTCGT TGAAGAGCTTGCATGCATGCATGCATGCATGAATTC E. palapyensis: CAGATACCATGGCTAAAAAGAAAATTCTGGCCGATTTTAGTCGTTGA AAGCTTTGCATGCATGCATGCATGCATGAATTC. Your advisor understands that your molecular biology skills acquired from school will definitely help you solve the entanglement. Use your molecular biology skills to solve the problem
Explanation / Answer
Promoter sequences are recognized by the RNA polymerase to transcribe DNA. Also, repressors can be developed that target these sequences and downregulate the transcription process. Since we know the sequence we can develop the repressor for E.gaboronensis. Supplementation of the media with this repressor will eliminate the unwanted organism and we will have solved the problem.
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.