8. From this study, they deduced the principle-35 and -10 promoter elements were

Question

8. From this study, they deduced the principle-35 and -10 promoter elements were as in the diagram below -35 -30 -25 -20 -15 10 +1 gapA PI Notably, in the abstract, the authors of the study state: "..the -35 sequence compensates for the presence of a suboptimal -10 hexamer....". Use the consensus sequence-deviation diagram below to deduce the degree of severity of the "suboptimal" status the authors ascribe to the -10 hexamer element? a. severely sub-optimal This is the E. coli consensus promoter with effect of deviations on promoter Transcription start site Promoter region 35 -10 b. mildly sub optimal GTT AGTGTATTGACATGATAGAAGCACTCTACTATATTCTCAATAGGT CCACGG -One-base Mild effects on transcription deletion CIG CA One-base change Two-base change ATSevere effects on transcription Figure 3-4 Genes and Genomics: A Short Course (3e) 2007 W.H.Freeman and C

Explanation / Answer

Answer:

Option A is correct.

Explanation:
Given sequence,
-10 hexamer = 5'-TAATTT-3'

Optimal -10 sequence = 5'-TATATTC-3'

Alignment:
Optimal sequence: 5'-TATATTC-3'
Given sequence: 5'-TAATTT--3'

3rd base is changed from T to A.
4th base is changed from A to T.

The double base change has severe effects on transcription.

Related Questions

Navigate

• Browse (All)
• Browse 8
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.