UGUCys UGA-Stop Phe ucC ser UAA StoP UGG TP UAU TyrUGC UAC UCU 1. The following
ID: 200925 • Letter: U
Question
UGUCys UGA-Stop Phe ucC ser UAA StoP UGG TP UAU TyrUGC UAC UCU 1. The following is part of a mature mRNA transcript. The sequence starts with the +1 nucleotide. The start codon is underlined. Using the genetic code, what are the first three amino acids encoded by this mR UUC UCA UUG UAG CUU CUC CUA CUG CAU HiS CGC Ag CAC- CAA Gin CGG CAG CCu NA? Leu CCC Pro CGA CCA CCG ACU AUC le ACC ACA AUG Met ACG AAU AAC JAsn AGUser AGC AGA Arg AGG AUU 5' UUUAAGGAUCCCAUGACUAAUAGU..3' Thr A AUA AAG GAU Asp GGC G GAC GCU GGU GUU GUC Val GCC Ala GAA Glu GGG G GUA GGA GUG GCG GAG 2. In the diagram below, which amino acid is will be attached to the next tRNA to enter the ribosome? 3. Which amino acid is bonded to the left side of the glycine (Gly) in the polypeptide being synthesized? Yes, I know the picture is cut off Use the mRNA sequence! Work backward to figure out the codon that coded for that amino aci Ser Ala GUGAGU CGA 5 GGGAACACUCAGCUGAGGAUACUAU 3Explanation / Answer
1A.From the start codon it will be metionine-threonine-aspargine-serine.
2A.The next trna will carry glutamic acid.
3A.The amino acid bonded to left side of glycine is phenylalanine. as the code for UUC is phenyl alanine.
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.