Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

RNA Help NCBI Reference Sequence: NM 000207.2 1 agccctccag gacaggctgc atcagaagag

ID: 203749 • Letter: R

Question

RNA Help

NCBI Reference Sequence: NM 000207.2 1 agccctccag gacaggctgc atcagaagag gccatcaagc agatcactgt ccttetgcca 61 tggccctgtg gatgegcctc ctgcccctgc tggcgetgct ggccctctgg ggacctgacc 121 cagccgcagc ctttgtgaac caacacctgt geggctcaca cctggtggaa getctctacc 181 tagtgtgcgg ggaacgaggc ttcttctaca cacccaagac ccgccgggag gcagaggacc 241 tgcaggtggg gcaggtggag ctgggegggg gccctggtgc aggcagcctg cagccettgg 301 ccctggaggg gtccctgcag aagcgtggca ttgtggaaca atgetgtacc agcatctgct 361 ccctctacca gctggagaac tactgcaact agacgcagcc cgcaggcage cccacacccg 421 ccgcctcctg caccgagaga gatggaataa agcccttgaa ccagcaaaa for homework and lab work which both receive a qrade Due date: Friday Jan 30 1. Using the gene sequence written above, design 2 oligos to be used in a PCR reaction in which you would 1ike to amplify the area between nucleotides 181 and 360 2. Using the gene sequence written above, design 2 oligos to be used in a PCR reaction in which you would like to amplify a 120 nts sequence. Underline the sequence to be NOTE: Each olionucleotide should be 20 bases, single stranded Write your oligo sequence in the 5'-> 3' format as shown below. If you have a question do not hesitate to ask. Example: 01igo A sequence: 5 tactacaactagacacaacc How many base pairs per line of sequence above? 3, 3, 3, 3, #1: oligo oligo Oligo oligo #1: #2: #1: #2: 5, 5, 5, 5, Tm= Tm= Tm= Tm= Ex Ex #2:

Explanation / Answer

Primers to amplify the region between 181 to 360

Forward primer: 5'-TAGTGTGCGGGGAACGAGGC-3'

Length: 20

GC content: 65%

Tm = 57.9 C

Reverse primer: 5'-AGCAGATGCTGGTACAGCAT-3'

Length: 20

GC content: 50%

Tm = 51.8 C

Primers to amplify the region between 1 to 120 (Fragment size = 120 bp)

Forward primer: 5'-AGCCCTCCAGGACAGGCTGC-3'

Length: 20

GC content: 70%

Tm = 60 c

Reverse primer: 5'-GGTCAGGTCCCCAGAGGGCC-3'

Length: 20

GC content: 75%

Tm = 62 C