Name ID: A 31. Cutting DNA into fragments and then figuring out their order is c

Question

Name ID: A 31. Cutting DNA into fragments and then figuring out their order is called a. restriction fragment length polymorphism (RFLP) b. restriction enzyme mapping c. restriction digest d. rDNA probing Short Answer 32. Use the table below Alull and HidIl. Mark the restriction sites and write out the resulting fragmts to show the resulting fragments after the following DNA segment has been cut with both Restriction Enzyme Recognition Site AG CT Bam HI Eco RI HinDI GAAATTC A AGCTT 3' TATTCGAAGAGGCCTAGGATTGCCTAGGTTCGAAT5' 33. Sketch out a flowchart or write an outline of the basic steps of a bacterial transformation beginning with a flask of host cells and ending with plated cells. are the three common methods to select for transformed cells? Describe each mechanism 35 Houw ane cela made Cempetent what oHen mefed mcnas trans formn

Explanation / Answer

Ans31 restriction enzyme mapping.

Restriction enzyme mapping is digestion of DNA by restriction endonucleases then run these fragments in gel electropheresis.

Related Questions

Navigate

• Browse (All)
• Browse N
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.