hat is the RNA strand to the following coding strand of DNA? 5\' ATCCCAAGGTATGCC
ID: 213893 • Letter: H
Question
hat is the RNA strand to the following coding strand of DNA? 5' ATCCCAAGGTATGCCCCGGGATTAACGA 3 3' 5" 3" RNA Translation During translation, the mRNA is used to produce a polypeptide chain. What organelle is used to produce this polypeptide chain? ° are comprised of rRNA, a small subunit and a large subunit. The mRNA is "read" in groups of three nucleotides, which are called These are read in the 5' to 3' direction. Translation has three phases: initiation, elongation, and termination. The initiation phase begins when mRNA attaches to ribosomes. The start codon for translation is AUG. If a RNA sequence has no AUG codon, then translation will NOT occur. As mRNA is read by the ribosome, tRNA will provide the complementary base pairing or anti-codon to match the mRNA. For AUG, the tRNA sequence (anti-codon) would be UAC. Each tRNA anti-codon, brings a specific amino acid to the ribosome. A tRNA's anti-codon determines which amino acid it can carry. The tRNA that contains UAC can ONLY carry Methionine or MET for short. The elongation phase will continue as the polypeptide chain gets longer and longer. The termination phase will occur when the ribosome reaches one of three stop codons: UAA, UAG, or UGA. .A mRNA sequence of 5' AUGGGUACCUAG 3' would have a tRNA sequence of 5'Explanation / Answer
3'_UAGGGUUCCAUACGGGGCCCUAAUUGCU_5'
5'_UCGUUAAUCCCGGGGCAUACCUUGGGAU_3'
ribosomes oraganells subunites are used to produce polypeptide chain by mRNA.
ribosomes subunites are comprised with rRNA , a small subunite and large subunite.
codones are read in three group
3'_UACCCAUGGAUC_5'
Related Questions
Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.