1. For the following Prokaryotic DNA strand, show the mRNA which would be transc
ID: 214408 • Letter: 1
Question
1. For the following Prokaryotic DNA strand, show the mRNA which would be transcribed from this strand and show the polypeptide which would be produced if the mRNA were translated. (See a codon chart for reference). 3' 5' ONA strand1 2 3 4 5 678 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 G CATTACGCTTTACTCTACATTG G mRNA: Protein Polypeptide: 2. in the DNA strand shown in the previous problem, what would be the effect on the resulting polypeptide if the following occurred? Be specific ie write out the result: Codon and amino acid A. Delete base 17? B. Changing A to G at base 13? C. Changing C to A at base 14? D. Changing C to T at base 9? 3. What are the names of these types of mutations? Mutation A- Mutation B Mutation C Mutation D On the DNA strand above, circle the areas that would be affected by UV radiation. Why doesn't UV light kill all of the bacterial cells?Explanation / Answer
1. mRNA of the given sequence is CGUAAUGCGAAAUGAGAUGUAAC. When DNA transcript into mRNA then A pairs with U and G pairs with C vice versa. Protein translated is arg asn ala Lys stop (UGA)
2 A) if there is deletion at 17th base then there is no effect on protein as it is termianatd after 13 base.
B) if 13th base A change to G then it's protein sequence will change as I told u that the given DNA sequence is stop or terminating after 13the base. So the sequence will be arg asn ala Lys arg asp Val thr
C) if change in 14 base will also change protein sequence that will be arg asn ala lys leu asp val thr
D) if there is change at 9 C to T then protein sequence will be arg asn ala Lys stop.
3. In case of A mutation there is no change in protein sequence so there is no mutation as the sequence is terminated after 13th base.
In case of B stop codon is mutated so protein synthesis it may be a reverse mutation i.e if during previous mutation there is change in this base then it might have changed to stop codon so after second mutation it revert back , it can also be a Opal suppression (Opal for UGA stop codon).
In case C is similar to B mutation there is change in stop codon base which result in fully synthesized protein
In case of D mutation it's silent mutation In which nucleotide is changed but amino acid (aa) remain same it because of degenerative nature of codon ( for single aa there are many codon)
UV light affect TT region because due to UV they make a rhyming dimer that result in mutation in protein synthesis and also result in faulty replication. Which kills all bacteria. The affected regions are GCA "TT" ACGC "TTT" ACTCTACA "TT" GG. ( Note : I just put " " marks those region get affected when a bacteria is exposed to UV light. There is also some cases in which bacteria does not killed by UV light because bacteria has their own defense mechanism which can break thymine dimer and continue the normal replication and translation)
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.