Given the DNA sequence below, if read from left to right by RNA polymerase, what

Question

Given the DNA sequence below, if read from left to right by RNA polymerase, what RNA would RNA polymerase synthesize? Please write your RNA in the 5'-3' direction and include ONLY letters (do not include the 3' or 5')

5-ATGCCCTTTCGAAGCTATGGGTAA

3-TACGGGAAAGCTTCGATACCCATT

The ribosome now will read the correct RNA from question #1 to make a protein. Please write the one letter amino acid code below (see table 2.2 on page 32 of your textbook). If you have a stop codon then please indicate the stop codon with a "-". An example of an answer with a stop codon would be "MTKEVLR-"

Explanation / Answer

1. RNA polymerase synthesizes mRNA

The RNA is 5'-3' direction will be :

AUGCCCUUUCGAAGCUAUGGG "UAA"

(The last codon UAA is a stop codon or a terminater).

2. One letter amino acid code is - CODON.

Related Questions

Navigate

• Browse (All)
• Browse G
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.