Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Given the DNA sequence below, which of the following could be a primer sequence

ID: 253413 • Letter: G

Question

Given the DNA sequence below, which of the following could be a primer sequence used in its replication? 5-CGTACGGCCCCAAAATTGCTACTCTGCTG-3' What is the difference between the leading strand and the lagging strand in DNA replication? Place the following steps of DNA replication in right chronological order. 1. Primase adds an ribonucleotide primer 2. Initiator proteins bind the origin of replication and helicase breaks hydrogen bonds betweern complementary bases of double stranded template DNA 3. DNA polymerase IIl extends by complementary base pairing deoxyribonucleotides to the template strand:s 4. Ligase phosphodiester bonds the nucleotides to connect okazaki fragments nad connect fragments at the origin and where the "crotches or forks" collide 5. DNA polymerase I removes RNA primer and replaces with Deoxyribonucleotides Which of the following is a protein whose job is to add complementary ribonucleotides to a deoxyribonucleotide template?

Explanation / Answer

DNA sequence with the polarity 5'?3' acts as a template, new DNA strand synthesis with the polarity 5'?3' so the direction of the polarity of parent strand will be 3'?5' . Primers were added near the 3' end.

5'CGTACGGCCCCAAAATTGCTACTCTGCTG3'

So the sequence of the polarity will be

3' ATGAGACGAC 5'

5' CGTACHGCCCCAAAATTGCTACTCTGCTG 3'

3' ATGAGACGAC 5'

Leading strand is the strand where DNA nucleotides added continuously by the DNA polymerase enzyme in the direction 5'?3' direction (parent strand as the polarity 3'?5').

And the other strand DNA nucleotides added discontinuously to form okazaki fragments (parent strand has the polarity 3'?5' from the replication fork).

DNA replication steps

1. Initiator protein binds to the origin of replication and Helicase breaks hydrogen bonds between complementary bases of double stranded template DNA.

2. Primase adds on ribonucleotide primer.

3. DNA polymerase III extends by complementary base pairing Deoxyribonucleotides to the template strands.

4. DNA polymerase I removes RNA primers and replaces with Deoxyribonucleotides.

5. Ligase phosphodiester bonds the nucleotide to connect okazaki fragments and connect fragments at the origin and where "crotches or forks " collide.

The protein whose job is to add complementary ribonucleotides to a deoxyribonucleotide template during DNA replication is Primase and during transcription the same is RNA polymerase enzyme.

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote